Review

ap3b1 hps2 (Proteintech)

Proteintech is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Proteintech ap3b1 hps2
IF images from cryosection stains from day 40 WT lung organoids cultured in the presence or absence or rhIL-11, as well as HPS1−/−, <t>HPS2−/−,</t> HPS4−/−, and HPS8−/− organoids. Red and green: corresponding IF markers indicated for each stain. Blue: DAPI stain. Scale bar: 100 μm.

IF images from cryosection stains from day 40 WT lung organoids cultured in the presence or absence or rhIL-11, as well as HPS1−/−, <t>HPS2−/−,</t> HPS4−/−, and HPS8−/− organoids. Red and green: corresponding IF markers indicated for each stain. Blue: DAPI stain. Scale bar: 100 μm.

Ap3b1 Hps2, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ap3b1+hps2/pmc06594401-9-0-3?v=Proteintech
Average 93 stars, based on 14 article reviews

ap3b1 hps2 - by Bioz Stars, 2026-08

93/100 stars

Images

1) Product Images from "Modeling of Fibrotic Lung Disease Using 3D Organoids Derived from Human Pluripotent Stem Cells"

Article Title: Modeling of Fibrotic Lung Disease Using 3D Organoids Derived from Human Pluripotent Stem Cells

Journal: Cell reports

doi: 10.1016/j.celrep.2019.05.077

IF images from cryosection stains from day 40 WT lung organoids cultured in the presence or absence or rhIL-11, as well as HPS1−/−, HPS2−/−, HPS4−/−, and HPS8−/− organoids. Red and green: corresponding IF markers indicated for each stain. Blue: DAPI stain. Scale bar: 100 μm.

Figure Legend Snippet: IF images from cryosection stains from day 40 WT lung organoids cultured in the presence or absence or rhIL-11, as well as HPS1−/−, HPS2−/−, HPS4−/−, and HPS8−/− organoids. Red and green: corresponding IF markers indicated for each stain. Blue: DAPI stain. Scale bar: 100 μm.

Techniques Used: Cell Culture, Staining

Figure Legend Snippet: KEY RESOURCES TABLE

Techniques Used: Recombinant, RNAscope, Multiplex Assay, Positive Control, Enzyme-linked Immunosorbent Assay, Sequencing, Plasmid Preparation, Software

Image Search Results

AP3B1 interacts with SARS-CoV-2 E. ( A ) A549 (ACE2) cells were infected with SARS-CoV-2 (MOI 1) and stained for endogenous AP3B1 (green) and SARS-CoV-2-E (red), revealing colocalization (yellow) of the two proteins. Scale bar represents 10 μM. Representative image shown from two independent experiments. White box depicts area shown in Inset. ( B ) Colocalization analysis of endogenous AP3B1 in uninfected A549 cells (green; Quadrant 2 of left panel) or cells infected with SARS-CoV-2 counterstained for the viral Envelope (E) protein (red; Quadrant 1 of right panel). Pixels where colocalization is apparent in Quadrant 3 are pseudo-colored white.

Journal: Viruses

Article Title: AP3B1 Has Type I Interferon-Independent Antiviral Function against SARS-CoV-2

doi: 10.3390/v16091377

Figure Lengend Snippet: AP3B1 interacts with SARS-CoV-2 E. ( A ) A549 (ACE2) cells were infected with SARS-CoV-2 (MOI 1) and stained for endogenous AP3B1 (green) and SARS-CoV-2-E (red), revealing colocalization (yellow) of the two proteins. Scale bar represents 10 μM. Representative image shown from two independent experiments. White box depicts area shown in Inset. ( B ) Colocalization analysis of endogenous AP3B1 in uninfected A549 cells (green; Quadrant 2 of left panel) or cells infected with SARS-CoV-2 counterstained for the viral Envelope (E) protein (red; Quadrant 1 of right panel). Pixels where colocalization is apparent in Quadrant 3 are pseudo-colored white.

Article Snippet: The following primers were used to amplify mRNA: AP3B1 (Origene, Rockville, MD, USA: Cat# HP207142) Fwd: GTGCCTCAATGGCTTGGTCTGT; Rev: GTGATACTGTCCAGGAGTTTGGC.

Techniques: Infection, Staining

AP3B1 interacts with SARS-CoV-2 E following ectopic expression. ( A ) HEK293 cells were transfected with Flag-SARS-CoV-2-E and HA-AP3B1. Co-immunoprecipitation of Flag-SARS-CoV-2-E was observed when HA-AP3B1 was subjected to affinity purification. Representative images shown from three independent experiments. ( B ) Co-immunoprecipitation of HA-AP3B1 following affinity purification of Flag-SARS-CoV-2 E. Representative images shown from three independent experiments. WCE, whole cell extract.

Journal: Viruses

Article Title: AP3B1 Has Type I Interferon-Independent Antiviral Function against SARS-CoV-2

doi: 10.3390/v16091377

Figure Lengend Snippet: AP3B1 interacts with SARS-CoV-2 E following ectopic expression. ( A ) HEK293 cells were transfected with Flag-SARS-CoV-2-E and HA-AP3B1. Co-immunoprecipitation of Flag-SARS-CoV-2-E was observed when HA-AP3B1 was subjected to affinity purification. Representative images shown from three independent experiments. ( B ) Co-immunoprecipitation of HA-AP3B1 following affinity purification of Flag-SARS-CoV-2 E. Representative images shown from three independent experiments. WCE, whole cell extract.

Article Snippet: The following primers were used to amplify mRNA: AP3B1 (Origene, Rockville, MD, USA: Cat# HP207142) Fwd: GTGCCTCAATGGCTTGGTCTGT; Rev: GTGATACTGTCCAGGAGTTTGGC.

Techniques: Expressing, Transfection, Immunoprecipitation, Affinity Purification

AP3B1 ear domain is insufficient for inhibition of SARS-CoV-2. ( A ) A549 cells expressing human ACE2 were transfected with plasmids encoding full-length AP3B1 or the ear domain of AP3B1 only and infected with SARS-CoV-2 for 48 h. Release of infectious virus was measured by plaque assay. ( B ) Samples from ( A ) were analyzed by Western blotting for SARS-CoV-2 spike protein expression and ( C ) viability by MTT assay. Representative images shown from two independent experiments. ( D ) Immunofluorescence analysis of colocalization between full-length HA-AP3B1 (top panel) or HA-AP3B1 ear domain (bottom panel) and SARS-CoV-2 E (red). Scale bar represents 10 μM. Representative images shown from two independent experiments. White box depicts area shown in Inset. ( E ) Quantification of correlation coefficient from two independent experiments; data points represent individual cells. Error bars represent mean ± SD with statistics from one-way ANOVA with ( A ) Tukey’s post test or ( B ) Sidak’s post test. Data in ( E ) analyzed by two-way t -test. NS, not significant, *** p < 0.0005, **** p < 0.0001.

Journal: Viruses

Article Title: AP3B1 Has Type I Interferon-Independent Antiviral Function against SARS-CoV-2

doi: 10.3390/v16091377

Figure Lengend Snippet: AP3B1 ear domain is insufficient for inhibition of SARS-CoV-2. ( A ) A549 cells expressing human ACE2 were transfected with plasmids encoding full-length AP3B1 or the ear domain of AP3B1 only and infected with SARS-CoV-2 for 48 h. Release of infectious virus was measured by plaque assay. ( B ) Samples from ( A ) were analyzed by Western blotting for SARS-CoV-2 spike protein expression and ( C ) viability by MTT assay. Representative images shown from two independent experiments. ( D ) Immunofluorescence analysis of colocalization between full-length HA-AP3B1 (top panel) or HA-AP3B1 ear domain (bottom panel) and SARS-CoV-2 E (red). Scale bar represents 10 μM. Representative images shown from two independent experiments. White box depicts area shown in Inset. ( E ) Quantification of correlation coefficient from two independent experiments; data points represent individual cells. Error bars represent mean ± SD with statistics from one-way ANOVA with ( A ) Tukey’s post test or ( B ) Sidak’s post test. Data in ( E ) analyzed by two-way t -test. NS, not significant, *** p < 0.0005, **** p < 0.0001.

Article Snippet: The following primers were used to amplify mRNA: AP3B1 (Origene, Rockville, MD, USA: Cat# HP207142) Fwd: GTGCCTCAATGGCTTGGTCTGT; Rev: GTGATACTGTCCAGGAGTTTGGC.

Techniques: Inhibition, Expressing, Transfection, Infection, Virus, Plaque Assay, Western Blot, MTT Assay, Immunofluorescence

AP3B1 is antiviral for SARS-CoV-2, not SARS-CoV. ( A ) A549 cells expressing human ACE2 were treated with siRNA against AP3B1 or a scrambled control, and infected with SARS-CoV-2. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants. **** p < 0.0001 by one-way ANOVA with Tukey’s post test. ( B ) Samples from ( A ) were analyzed by Western blotting for SARS-CoV-2 spike protein expression and AP3B1 protein levels. Representative image shown from three independent experiments. ( C ) Immunofluorescence staining for viral dsRNA (red) in SARS-CoV-2-infected A549 cells expressing human ACE2 treated with siRNA against AP3B1 or a scrambled control. Scale bar represents 30 μM. DAPI staining of nuclei is shown in blue. ( D ) Quantification of ( C ) across four fields and analyzed by standard t -test. ( E ) A549 cells expressing human ACE2 were treated with siRNA against AP3D1 or a scrambled control, and infected with SARS-CoV-2. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants from three experiments. NS, not significant measured by one-way ANOVA. ( F ) A549 cells expressing human ACE2 were treated with siRNA against AP3B1 or a scrambled control, and infected with SARS-CoV. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants from three experiments. NS, not significant measured by one-way ANOVA. ( G ) Samples from ( F ) were analyzed by Western blotting for SARS-CoV spike protein expression. All error bars represent mean ± SD.

Journal: Viruses

Article Title: AP3B1 Has Type I Interferon-Independent Antiviral Function against SARS-CoV-2

doi: 10.3390/v16091377

Figure Lengend Snippet: AP3B1 is antiviral for SARS-CoV-2, not SARS-CoV. ( A ) A549 cells expressing human ACE2 were treated with siRNA against AP3B1 or a scrambled control, and infected with SARS-CoV-2. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants. **** p < 0.0001 by one-way ANOVA with Tukey’s post test. ( B ) Samples from ( A ) were analyzed by Western blotting for SARS-CoV-2 spike protein expression and AP3B1 protein levels. Representative image shown from three independent experiments. ( C ) Immunofluorescence staining for viral dsRNA (red) in SARS-CoV-2-infected A549 cells expressing human ACE2 treated with siRNA against AP3B1 or a scrambled control. Scale bar represents 30 μM. DAPI staining of nuclei is shown in blue. ( D ) Quantification of ( C ) across four fields and analyzed by standard t -test. ( E ) A549 cells expressing human ACE2 were treated with siRNA against AP3D1 or a scrambled control, and infected with SARS-CoV-2. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants from three experiments. NS, not significant measured by one-way ANOVA. ( F ) A549 cells expressing human ACE2 were treated with siRNA against AP3B1 or a scrambled control, and infected with SARS-CoV. Virus replication was monitored over time by plaque assays of infectious virus in cell supernatants from three experiments. NS, not significant measured by one-way ANOVA. ( G ) Samples from ( F ) were analyzed by Western blotting for SARS-CoV spike protein expression. All error bars represent mean ± SD.

Article Snippet: The following primers were used to amplify mRNA: AP3B1 (Origene, Rockville, MD, USA: Cat# HP207142) Fwd: GTGCCTCAATGGCTTGGTCTGT; Rev: GTGATACTGTCCAGGAGTTTGGC.

Techniques: Expressing, Control, Infection, Virus, Western Blot, Immunofluorescence, Staining

AP3B1 is not interferon inducible. ( A ) A549 cells expressing human ACE2 were treated with 100 units/mL of IFNβ and analyzed for ISG15 and AP3B1 protein expression or ( B ) expression of AP3B1, IFITM1, and ISG15 mRNA normalized to 18s ribosomal RNA. Increased expression of ISG15 and IFITM1 confirms IFNβ stimulation of treated cells. Error bars represent mean ± SD; statistics performed by unpaired t -test; ns = not significant, ** p < 0.005, *** p < 0.0005.

Journal: Viruses

Article Title: AP3B1 Has Type I Interferon-Independent Antiviral Function against SARS-CoV-2

doi: 10.3390/v16091377

Figure Lengend Snippet: AP3B1 is not interferon inducible. ( A ) A549 cells expressing human ACE2 were treated with 100 units/mL of IFNβ and analyzed for ISG15 and AP3B1 protein expression or ( B ) expression of AP3B1, IFITM1, and ISG15 mRNA normalized to 18s ribosomal RNA. Increased expression of ISG15 and IFITM1 confirms IFNβ stimulation of treated cells. Error bars represent mean ± SD; statistics performed by unpaired t -test; ns = not significant, ** p < 0.005, *** p < 0.0005.

Article Snippet: The following primers were used to amplify mRNA: AP3B1 (Origene, Rockville, MD, USA: Cat# HP207142) Fwd: GTGCCTCAATGGCTTGGTCTGT; Rev: GTGATACTGTCCAGGAGTTTGGC.

Techniques: Expressing

Journal: Cell reports

Article Title: Modeling of Fibrotic Lung Disease Using 3D Organoids Derived from Human Pluripotent Stem Cells

doi: 10.1016/j.celrep.2019.05.077

Figure Lengend Snippet: IF images from cryosection stains from day 40 WT lung organoids cultured in the presence or absence or rhIL-11, as well as HPS1−/−, HPS2−/−, HPS4−/−, and HPS8−/− organoids. Red and green: corresponding IF markers indicated for each stain. Blue: DAPI stain. Scale bar: 100 μm.

Article Snippet: AP3B1 (HPS2) , Proteintech Group , Cat#13384–1-AP, RRID:AB_2056499.

Techniques: Cell Culture, Staining

Journal: Cell reports

Article Title: Modeling of Fibrotic Lung Disease Using 3D Organoids Derived from Human Pluripotent Stem Cells

doi: 10.1016/j.celrep.2019.05.077

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: AP3B1 (HPS2) , Proteintech Group , Cat#13384–1-AP, RRID:AB_2056499.

Techniques: Recombinant, RNAscope, Multiplex Assay, Positive Control, Enzyme-linked Immunosorbent Assay, Sequencing, Plasmid Preparation, Software

Review

Structured Review

Images

1) Product Images from "Modeling of Fibrotic Lung Disease Using 3D Organoids Derived from Human Pluripotent Stem Cells"

Similar Products

Image Search Results